These template files are useful if you would like to add new data to PromoterCAD, such as for a new organisms, experimental measurements, or motif identification methods.
Tutorial Page:value
#LINK | |||||||||||||
#lang | en | ||||||||||||
#attribution_name | GenoCon | ||||||||||||
#attribution_url | http://promotercad.org | ||||||||||||
#license | http://creativecommons.org/publicdomain/zero/1.0/deed.ja | ||||||||||||
#file_name | MammalianPromoterCAD_PEDB_Template | ||||||||||||
#download_from | http://linkdata.org/work/rdf1s1068i | ||||||||||||
#namespace | BioGPS | http://biogps.org/#goto=genereport&id= | |||||||||||
#namespace | Gene | http://www.ncbi.nlm.nih.gov/gene/ | |||||||||||
#namespace | PEDB | http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE= | |||||||||||
#namespace | PEDB_motif | http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id= | |||||||||||
#property | motif | motif type | motif sequence | motif position | chromosome | strand | start | end | TSS | PEDB | BioGPS | Probe ID | label:Gene Expression Property 1 |
#object_type_xsd | string | string | string | float | string | string | integer | integer | integer | string | string | string | float |
#property_context | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion | Assertion |
Gene:102910 | PEDB_motif:19768833 | E-box | AGCCCCCACGTGACCCGG | 3015.5 | X | + | 124693675 | 124693658 | 124696682 | PEDB:102910 | BioGPS:102910 | 1427167_at | |
Gene:110651 | PEDB_motif:19771750 | RRE | AACCAGTGACCTACTTTCTATCT | 8945 | X | + | 149237195 | 149237173 | 149246129 | PEDB:110651 | BioGPS:110651 | 1455206_at | |
Gene:11878 | PEDB_motif:19771030 | D-box | CAAGCGGATTATGTCACATTTCCT | 4046.5 | X | + | 84833993 | 84834016 | 84838051 | PEDB:11878 | BioGPS:11878 | 1450042_at | |
Gene:12070 | PEDB_motif:19768588 | E-box | GGCCCTCACGTGACCCGG | 524.5 | X | + | 126277453 | 126277436 | 126277969 | PEDB:12070 | BioGPS:12070 | 1428842_a_at | |
Gene:15354 | PEDB_motif:19771031 | D-box | CTGGCTCATCACATAATCAGAAGC | 5346.5 | X | + | 63116803 | 63116780 | 63122138 | PEDB:15354 | BioGPS:15354 | 1416155_at | |
Gene:16179 | PEDB_motif:19773717 | RRE | AGAAAATAAGTAGGTCGTTTTAA | 3145 | X | - | 65585461 | 65585439 | 65582305 | PEDB:16179 | BioGPS:16179 | 1438120_x_at | |
Gene:17763 | PEDB_motif:19771695 | RRE | CAGTACTGACCTAATTTGGATCT | 697 | X | - | 66967616 | 66967638 | 66966930 | PEDB:17763 | BioGPS:17763 | 1449897_a_at | |
Gene:18715 | PEDB_motif:19774599 | RRE | CCCAGCCAGGTGGGTCATGGACT | 6061 | X | + | 6161170 | 6161192 | 6167242 | PEDB:18715 | BioGPS:18715 | 1417216_at | |
Gene:18824 | PEDB_motif:19768567 | E-box | GGCCTCCACCTGGCCCGG | 44.5 | X | - | 5960387 | 5960404 | 5960351 | PEDB:18824 | BioGPS:18824 | 1453572_a_at | |
Gene:20229 | PEDB_motif:19769416 | D-box | TGTGGGTGTTATGTAACACCTGTT | 105.5 | X | - | 145130299 | 145130276 | 145130182 | PEDB:20229 | BioGPS:20229 | 1420502_at | |
Gene:20591 | PEDB_motif:19768316 | E-box | CCTTGCCACTTGCAGCCT | 9138.5 | X | + | 142111539 | 142111556 | 142120686 | PEDB:20591 | BioGPS:20591 | 1444158_at | |
Gene:20591 | PEDB_motif:19773274 | RRE | ATGAAATGAACTATTTTCTCTTA | 190 | X | + | 142120507 | 142120485 | 142120686 | PEDB:20591 | BioGPS:20591 | 1444158_at | |
Gene:21947 | PEDB_motif:19773918 | RRE | GGTAGAAAAATAGGTCAGGAGAA | 1847 | X | + | 48862751 | 48862773 | 48864609 | PEDB:21947 | BioGPS:21947 | 1422283_at | |
Gene:22289 | PEDB_motif:19768574 | E-box | AAAGGTCACGTGAGGCGA | 56.5 | X | + | 16494263 | 16494280 | 16494328 | PEDB:22289 | BioGPS:22289 | 1427672_a_at | |
Gene:22773 | PEDB_motif:19773957 | RRE | CGGTACCCGGTAGGTCAGCGGCG | 2331 | X | + | 49680767 | 49680789 | 49683109 | PEDB:22773 | BioGPS:22773 | 1423424_at | |
Gene:236904 | PEDB_motif:19768510 | E-box | CCCTGGCTCGTGGCCCTC | 31.5 | X | + | 85786432 | 85786415 | 85786455 | PEDB:236904 | BioGPS:236904 | 1435818_at | |
Gene:237010 | PEDB_motif:19773072 | RRE | CCTTAATGAGCTACATTCAAATT | 502 | X | + | 105801294 | 105801272 | 105801785 | PEDB:237010 | BioGPS:237010 | 1439078_at | |
Gene:237052 | PEDB_motif:19768992 | E-box | TCCCCTCACGTGACCAGG | 20.5 | X | + | 126715154 | 126715137 | 126715166 | PEDB:237052 | BioGPS:237052 | 1424634_at | |
Gene:23947 | PEDB_motif:19771351 | D-box | TAATTTCATCACATACTCCCAGCC | 3853.5 | X | + | 130668276 | 130668253 | 130672118 | PEDB:23947 | BioGPS:23947 | 1422216_at | |
Gene:23947 | PEDB_motif:19771009 | D-box | GCAGCTGCTTATGTGATGTGATTA | 3734.5 | X | + | 130668372 | 130668395 | 130672118 | PEDB:23947 | BioGPS:23947 | 1422216_at | |
Gene:23963 | PEDB_motif:19772875 | RRE | AAAAAAAAAGTGGGACATAGATA | 6174 | X | + | 35771097 | 35771119 | 35777282 | PEDB:23963 | BioGPS:23963 | 1458842_at | |
Gene:245643 | PEDB_motif:19773385 | RRE | GAGGAGAAATAGGGTCAGTGAAG | 5116 | X | + | 130384006 | 130384028 | 130389133 | PEDB:245643 | BioGPS:245643 | 1441363_at | |
Gene:50786 | PEDB_motif:19772915 | RRE | CCGCCCTGAGCCACTTTCCTGTT | 1979 | X | - | 43870538 | 43870560 | 43868570 | PEDB:50786 | BioGPS:50786 | 1450047_at | |
Gene:53332 | PEDB_motif:19771735 | RRE | TATATTAAAGTAGGTCATTTAAA | 6626 | X | + | 62950771 | 62950793 | 62957408 | PEDB:53332 | BioGPS:53332 | 1421880_at | |
Gene:55936 | PEDB_motif:19773728 | RRE | CCACACTGACCTGCATTTACATT | 4999 | X | + | 152866130 | 152866108 | 152871118 | PEDB:55936 | BioGPS:55936 | 1448111_at | |
Gene:56364 | PEDB_motif:19768718 | E-box | CGGGGCCCCGGGCGGGGG | 178.5 | X | - | 92823595 | 92823578 | 92823408 | PEDB:56364 | BioGPS:56364 | 1417794_at | |
Gene:68041 | PEDB_motif:19768369 | E-box | CATGTCCACGTGCATCCG | 438.5 | X | + | 9048714 | 9048731 | 9049161 | PEDB:68041 | BioGPS:68041 | 1416840_at | |
Gene:107527 | PEDB_motif:19772271 | RRE | AGAAACTGACCTATTTAACAAAT | 9888 | 1 | + | 40639434 | 40639412 | 40649311 | PEDB:107527 | BioGPS:107527 | 1434903_s_at | |
Gene:108657 | PEDB_motif:19768502 | E-box | GCCATGCACGTGGCCTCG | 63.5 | 1 | + | 92844682 | 92844665 | 92844737 | PEDB:108657 | BioGPS:108657 | 1454753_at | |
Gene:114668 | PEDB_motif:19772824 | RRE | GGTAACTGACCCACTTCCCAGCA | 1466 | 1 | - | 185095561 | 185095583 | 185094106 | PEDB:114668 | BioGPS:114668 | 1432336_at | |
Gene:11807 | PEDB_motif:19774116 | RRE | AGGAAATGACCTCCTTTCAAATC | 453 | 1 | + | 171292974 | 171292952 | 171293416 | PEDB:11807 | BioGPS:11807 | 1417950_a_at | |
Gene:11899 | PEDB_motif:19768784 | E-box | CTACTCCACGTGGCTCCC | 7842.5 | 1 | + | 158597213 | 158597196 | 158605047 | PEDB:11899 | BioGPS:11899 | 1418615_at | |
Gene:11905 | PEDB_motif:19769536 | D-box | AGCACTGGTTATGTAATAAGTTAC | 9238.5 | 1 | + | 160977516 | 160977539 | 160986766 | PEDB:11905 | BioGPS:11905 | 1417909_at | |
Gene:12946 | PEDB_motif:19770374 | D-box | ACAAGTTGGTATATAATGAAATTG | 9604.5 | 1 | - | 195034538 | 195034515 | 195024922 | PEDB:12946 | BioGPS:12946 | 1422563_at | |
Gene:13798 | PEDB_motif:19768898 | E-box | CCGCACCACGAGGCCCCA | 4248.5 | 1 | + | 120371788 | 120371771 | 120376028 | PEDB:13798 | BioGPS:13798 | 1418618_at | |
Gene:13800 | PEDB_motif:19771267 | D-box | GCTGTGTGTTATGTAAGCTTATAT | 8872.5 | 1 | - | 182016255 | 182016232 | 182007371 | PEDB:13800 | BioGPS:13800 | 1424800_at | |
Gene:14472 | PEDB_motif:19768534 | E-box | CGGTCCCACGTGACACGA | 71.5 | 1 | - | 89839742 | 89839725 | 89839662 | PEDB:14472 | BioGPS:14472 | 1420337_at | |
Gene:14472 | PEDB_motif:19770175 | D-box | TGCTTGTGATACATAACACACGTC | 1314.5 | 1 | - | 89840965 | 89840988 | 89839662 | PEDB:14472 | BioGPS:14472 | 1420337_at | |
Gene:14472 | PEDB_motif:19769605 | D-box | TGGCTCTTTTACATAATTGCAGGA | 3629.5 | 1 | - | 89843280 | 89843303 | 89839662 | PEDB:14472 | BioGPS:14472 | 1420337_at | |
Gene:15365 | PEDB_motif:19770989 | D-box | ACTGCATTTTACATAATTCCCTCT | 4879.5 | 1 | - | 177133381 | 177133404 | 177128513 | PEDB:15365 | BioGPS:15365 | 1440559_at | |
Gene:16171 | PEDB_motif:19772476 | RRE | GTTTTCTGACCCACTTTAAATCA | 8686 | 1 | + | 20931107 | 20931085 | 20939782 | PEDB:16171 | BioGPS:16171 | 1421672_at | |
Gene:17912 | PEDB_motif:19771620 | RRE | TGGTGCTGACCCACTTTCCTCTT | 41 | 1 | - | 52269988 | 52270010 | 52269958 | PEDB:17912 | BioGPS:17912 | 1459679_s_at | |
Gene:17975 | PEDB_motif:19774664 | RRE | TCTCATTGAGCTCCTTTCTGTCC | 444 | 1 | - | 86236626 | 86236648 | 86236193 | PEDB:17975 | BioGPS:17975 | 1415771_at | |
Gene:18143 | PEDB_motif:19771792 | RRE | AGAGAATGACCTACTTTACTGGG | 1857 | 1 | + | 39515362 | 39515340 | 39517208 | PEDB:18143 | BioGPS:18143 | 1421037_at | |
Gene:18143 | PEDB_motif:19772187 | RRE | GAAAAATATGTAGGTCAGTGGAA | 926 | 1 | + | 39516271 | 39516293 | 39517208 | PEDB:18143 | BioGPS:18143 | 1421037_at | |
Gene:18143 | PEDB_motif:19773603 | RRE | GATCCTTGACCCATTTTCCTGAC | 761 | 1 | + | 39516458 | 39516436 | 39517208 | PEDB:18143 | BioGPS:18143 | 1421037_at | |
Gene:18627 | PEDB_motif:19769182 | D-box | TGTGCGTCTTATGTAAAGAGAGCG | 115.5 | 1 | - | 91377818 | 91377795 | 91377691 | PEDB:18627 | BioGPS:18627 | 1417602_at | |
Gene:19243 | PEDB_motif:19769588 | D-box | TGATGTTCTTATGTAAGGCTGCCT | 4565.5 | 1 | - | 31225943 | 31225920 | 31221366 | PEDB:19243 | BioGPS:19243 | 1438657_x_at | |
Gene:19264 | PEDB_motif:19774430 | RRE | CATGGCTGACCTAGTTAATTTCT | 464 | 1 | - | 137962189 | 137962211 | 137961736 | PEDB:19264 | BioGPS:19264 | 1422124_a_at | |
Gene:20720 | PEDB_motif:19768655 | E-box | ACGATCCACGTGCAGCTC | 255.5 | 1 | - | 80372573 | 80372556 | 80372309 | PEDB:20720 | BioGPS:20720 | 1416666_at | |
Gene:20724 | PEDB_motif:19774336 | RRE | AGATCTTGTCCTACTTTAAACGT | 3888 | 1 | + | 106839300 | 106839278 | 106843177 | PEDB:20724 | BioGPS:20724 | 1441941_x_at | |
Gene:208727 | PEDB_motif:19769459 | D-box | TCTGCTTGTTATGTAATGTGACAA | 53.5 | 1 | - | 92038581 | 92038558 | 92038516 | PEDB:208727 | BioGPS:208727 | 1436758_at | |
Gene:212980 | PEDB_motif:19768570 | E-box | AGGAGCCACGCGGGGGCT | 174.5 | 1 | + | 131835074 | 131835091 | 131835257 | PEDB:212980 | BioGPS:212980 | 1426664_x_at | |
Gene:21808 | PEDB_motif:19771540 | RRE | GTTGAAAAAGTGGGTCAGAAACA | 3633 | 1 | - | 186297243 | 186297221 | 186293599 | PEDB:21808 | BioGPS:21808 | 1423250_a_at | |
Gene:22409 | PEDB_motif:19768520 | E-box | TGAGGCCACGTGCTCCCA | 2531.5 | 1 | + | 75249086 | 75249103 | 75251626 | PEDB:22409 | BioGPS:22409 | 1460657_at | |
Gene:22637 | PEDB_motif:19769028 | E-box | CAGGAGCATGTGGCCTGT | 58.5 | 1 | + | 37084421 | 37084404 | 37084471 | PEDB:22637 | BioGPS:22637 | 1422701_at | |
Gene:226646 | PEDB_motif:19774526 | RRE | TGGCCCTGACTTATTTTCCACTT | 135 | 1 | - | 171312375 | 171312397 | 171312251 | PEDB:226646 | BioGPS:226646 | 1451096_at | |
Gene:226896 | PEDB_motif:19769547 | D-box | CGGCAAGATTACATAATGAAGTCA | 8425.5 | 1 | + | 19301791 | 19301768 | 19310205 | PEDB:226896 | BioGPS:226896 | 1425443_at | |
Gene:227195 | PEDB_motif:19769078 | E-box | AGGAGTCAGGTGCAGCCG | 570.5 | 1 | - | 63506259 | 63506242 | 63505680 | PEDB:227195 | BioGPS:227195 | 1439180_at | |
Gene:22782 | PEDB_motif:19768213 | E-box | CCGCTGCACGCGGCCCGC | 331.5 | 1 | + | 191802619 | 191802602 | 191802942 | PEDB:22782 | BioGPS:22782 | 1436164_at | |
Gene:23792 | PEDB_motif:19768711 | E-box | CATGGCCACGAGCAGGCT | 3873.5 | 1 | + | 63973688 | 63973705 | 63977570 | PEDB:23792 | BioGPS:23792 | 1447946_at | |
Gene:240843 | PEDB_motif:19773490 | RRE | AGAAGGAAAATGGCTCAAATGGG | 402 | 1 | - | 158356916 | 158356894 | 158356503 | PEDB:240843 | BioGPS:240843 | 1438706_at | |
Gene:241201 | PEDB_motif:19773786 | RRE | AAGAAAAAAGTAGGGCAGTCCGA | 988 | 1 | + | 109986639 | 109986661 | 109987638 | PEDB:241201 | BioGPS:241201 | 1460045_at | |
Gene:56210 | PEDB_motif:19774591 | RRE | TCTCACAGACCCACTGTCTCCCG | 135 | 1 | - | 38321180 | 38321202 | 38321056 | PEDB:56210 | BioGPS:56210 | 1422624_at | |
Gene:56210 | PEDB_motif:19768620 | E-box | ACGGCGCTCGCGGCCCCG | 171.5 | 1 | - | 38321219 | 38321236 | 38321056 | PEDB:56210 | BioGPS:56210 | 1422624_at | |
Gene:57339 | PEDB_motif:19768486 | E-box | CCGGCTCACGTGGGCGGG | 97.5 | 1 | - | 17304394 | 17304411 | 17304305 | PEDB:57339 | BioGPS:57339 | 1421520_at | |
Gene:66153 | PEDB_motif:19769885 | D-box | AATAGGTTTTATGTAATCCACACA | 1549.5 | 1 | + | 85366830 | 85366853 | 85368391 | PEDB:66153 | BioGPS:66153 | 1449418_s_at | |
Gene:69953 | PEDB_motif:19774067 | RRE | ACTTCCTGAGCCAGTTTCTCTCT | 8131 | 1 | + | 157405753 | 157405731 | 157413873 | PEDB:69953 | BioGPS:69953 | 1428452_at | |
Gene:69953 | PEDB_motif:19770636 | D-box | AAGAACTATTACATAAAACCCTCT | 7040.5 | 1 | + | 157406844 | 157406821 | 157413873 | PEDB:69953 | BioGPS:69953 | 1428452_at | |
Gene:70579 | PEDB_motif:19768589 | E-box | CCGTGACACGTGACCCTA | 135.5 | 1 | - | 133549397 | 133549380 | 133549253 | PEDB:70579 | BioGPS:70579 | 1415764_at | |
Gene:72585 | PEDB_motif:19769002 | E-box | AGCCGTCACGTGGTACCC | 29.5 | 1 | - | 125743531 | 125743548 | 125743510 | PEDB:72585 | BioGPS:72585 | 1431569_a_at | |
Gene:72750 | PEDB_motif:19768845 | E-box | CAGCCCCACGCGCGGCGG | 245.5 | 1 | + | 60317274 | 60317291 | 60317528 | PEDB:72750 | BioGPS:72750 | 1434010_at | |
Gene:72951 | PEDB_motif:19768336 | E-box | ACCAACCACGTGAGGGCG | 213.5 | 1 | - | 26071450 | 26071433 | 26071228 | PEDB:72951 | BioGPS:72951 | 1433388_at | |
Gene:78605 | PEDB_motif:19773988 | RRE | TGATTAAAAATAGGTCACCCAAA | 3201 | 1 | - | 88190666 | 88190644 | 88187454 | PEDB:78605 | BioGPS:78605 | 1433685_a_at | |
Gene:80721 | PEDB_motif:19770522 | D-box | GGAGCCCCTTATGTACCCTCTACA | 6851.5 | 1 | - | 83569648 | 83569625 | 83562785 | PEDB:80721 | BioGPS:80721 | 1436417_at | |
Gene:93840 | PEDB_motif:19770848 | D-box | GAGACTGATTAAATAAGGGGAATT | 8616.5 | 1 | - | 172087920 | 172087943 | 172079315 | PEDB:93840 | BioGPS:93840 | 1436118_at | |
Gene:93842 | PEDB_motif:19768105 | E-box | AGAGCCCACGTGCGACCG | 161.5 | 1 | + | 172606324 | 172606341 | 172606494 | PEDB:93842 | BioGPS:93842 | 1420518_a_at | |
Gene:96890 | PEDB_motif:19768206 | E-box | AGGGGCCAGGTGCGGGCA | 1300.5 | 1 | - | 134907665 | 134907648 | 134906356 | PEDB:96890 | BioGPS:96890 | 1445905_at | |
Gene:108699 | PEDB_motif:19770201 | D-box | GCTGCTTCTTACGTAATGCTGCTC | 2275.5 | 2 | - | 73551513 | 73551490 | 73549226 | PEDB:108699 | BioGPS:108699 | 1420545_a_at | |
Gene:11800 | PEDB_motif:19774690 | RRE | GCACAAGAAGTTGGTCAGCTTGC | 5498 | 2 | - | 94306224 | 94306202 | 94300715 | PEDB:11800 | BioGPS:11800 | 1437593_x_at | |
Gene:11898 | PEDB_motif:19768228 | E-box | CGTCCCCACGTGTCCCAG | 30.5 | 2 | + | 31430268 | 31430251 | 31430290 | PEDB:11898 | BioGPS:11898 | 1416239_at | |
Gene:12236 | PEDB_motif:19770833 | D-box | CAAATATATTACATAGTAGCAGGA | 7196.5 | 2 | + | 118405965 | 118405942 | 118413150 | PEDB:12236 | BioGPS:12236 | 1447363_s_at | |
Gene:12335 | PEDB_motif:19769577 | D-box | TGGCCCTCTTATGTAACCACCCTG | 6867.5 | 2 | + | 120238570 | 120238593 | 120245449 | PEDB:12335 | BioGPS:12335 | 1433681_x_at | |
Gene:13537 | PEDB_motif:19768509 | E-box | GAGTCCCACGTGAAGCCG | 106.5 | 2 | + | 127085067 | 127085084 | 127085182 | PEDB:13537 | BioGPS:13537 | 1450698_at | |
Gene:13555 | PEDB_motif:19768429 | E-box | CGGCGGCGCGTGGCTCTT | 47.5 | 2 | - | 154633240 | 154633257 | 154633201 | PEDB:13555 | BioGPS:13555 | 1431875_a_at | |
Gene:13661 | PEDB_motif:19769873 | D-box | GGTGGGTTTTATGTTAACAACCTA | 2502.5 | 2 | - | 103186490 | 103186467 | 103183976 | PEDB:13661 | BioGPS:13661 | 1451375_at |