Please browse an image to upload.
| #LINK | ||
| #lang | en | |
| #attribution_name | GenoCon | |
| #attribution_url | http://atted.jp/download.shtml | |
| #license | http://creativecommons.org/publicdomain/zero/1.0/deed.ja | |
| #file_name | tooltip_PromoterCAD_menus_buttons | |
| #download_from | http://linkdata.org/work/rdf1s484i | |
| #namespace | PubMed | http://www.ncbi.nlm.nih.gov/pubmed/ |
| #property | explanation | PubMed |
| #object_type_xsd | string | string |
| #property_context | Assertion | Assertion |
| atgenexpress | Database of microarray expression measurements for different developmental tissues of Arabidopsis thaliana. | PubMed:15806101 |
| diurnal | Database of microarray expression measurements for seedling Arabidopsis thaliana plants grown in a variety of conditions. | PubMed:18419293 |
| selectexpressiondatabase | A series of measurements of many genes in the target organism, changing variables such as the developmental tissue (AtGenExpress) or the time of day each gene is measured (DIURNAL). | |
| atted-ii | A database which uses the AtGenExpress microarray data set to compare genes with similar expression patterns and look for 7 base-pair motifs they have in common. This database also predicts the location at which a given motif might be most effective. | PubMed:17130150 |
| ppdb | The Plant Promoter Database. Plant Promoters are analyzed by word frequency in a region 500 base-pairs upstream of the Transcriptional Start Site, using 8 base-pair motifs. These motifs are used to categorize regulatory elements, along with TATA box and Y-patch features. | PubMed:17346352 |
| selectmotifdatabase | Choose the database for the regulatory motif annotations that will be extracted from the promoters. There are several methods for predicting and annotating regulatory motifs. | |
| selecttool | 3. Select the tool MotifExpress, and make sure the " max " setting is checked. | |
| motifexpress | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. | |
| motifcircadian | This tool searches for genes which have a large circadian amplitude, and returns motifs identified from that gene. | |
| motifrank | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. The user is able to select from the top 10 genes for a given property. Contributed by Mochizuki san. | |
| motifquery | This tool combines search criteria from several gene expression properties, to find genes with useful expression profiles. | |
| userinputmotif | Since users my have prior knowledge of specific regulatory motifs, we provide a simple interface to allow users to input such data and use it for PromoterCAD designs. | |
| selectdatatable | Collection of Gene Expression Properties organized by type, such as tissues involved in the same organ (flowering), or data time courses taken in the same growth condition. | |
| selectproperty | 4. Select a gene expression property such as Col-0_roset12. & #13; & #10;5. PromoterCAD will find the gene with the highest expression in that leaf, return information about it, and show its predicted cis-regulatory motifs aligned with the empty promoter sequence. | |
| basesequence | The promoter sequence starts off as 500 blank base pairs. The downstream region has been fixed to 50 base-pairs taken from the Cauliflower Mosiac virus minimal promoter region. If you would like to add your own motifs at this point, you can place them manually in the sequence. You can also add your own motifs one at a time during the design process. The total sequence length is currently fixed to 500 base pairs. | |
| selectdatabase | 2. First select the database AtGenExpress_ATTED_Leaf. | |
| selectrange | Choose the phase of the circadian rhythm to search for. 0 hours is defined as the first night to day transition. The light cycle conditions will depend on the particular experiment. | |
| gacccttcctctatataaggaagttcatttcatttggagaggacctcgac | This is the minimal promoter element from the CaMV35S promoter. Currently this sequence is fixed. | |
| hanadb | External data visualization by HanaDB, a database of plant tissue expression measurements, similar to AtGenExpress. This database also provides a picture representation of each plant tissue, with the gene expression level represented as a heat scale. | |
| efp | External data visualization by the Arabidopsis eFP browser. This is a visualization of the AtGenExpress data, showing the gene expression level in different tissues as a heat scale. | PubMed:17684564 |
| addanothermotif | User input of motif sequence and position. Use this if there is a particular motif you would like to add to your promoter design. You can continue to add motifs one at a time. | |
| replace | 6. Click " Add Motifs " to incoporate all of the gene's identified motifs into the promoter motif skeleton. | |
| finishnow | Now we fill in the skeleton (the 'bones' of the promoter, containing just regulatory motifs and the minimal promoter region) with the remaining sequence. | |
| next | 7. Click " Next " to start a new data mining step using the promoter skeleton you have constructed so far. | |
| start | 1. START your promoter design with the empty sequence in the region -51 to -550 from the transcriptional start site. | |
Koro_Nishikata
Robert_Cox
