Please browse an image to upload.
| #LINK | ||
| #lang | en | |
| #attribution_name | GenoCon | |
| #attribution_url | http://atted.jp/download.shtml | |
| #license | http://creativecommons.org/publicdomain/zero/1.0/deed.ja | |
| #file_name | tooltip_PromoterCAD_menus_buttons | |
| #download_from | http://linkdata.org/work/rdf1s592i | |
| #namespace | PubMed | http://www.ncbi.nlm.nih.gov/pubmed/ |
| #property | explanation | PubMed |
| #object_type_xsd | string | string |
| #property_context | Assertion | Assertion |
| Expression Database | A series of measurements of many genes in the target organism, changing variables such as the developmental tissue (AtGenExpress) or the time of day each gene is measured (DIURNAL). | |
| Analysis Method | Choose the database for the regulatory motif annotations that will be extracted from the promoters. There are several methods for predicting and annotating regulatory motifs: experimental, bioinformatic, or a combination of both. See the data table record at promotercad.org for references. | |
| Select Tool | Pick the data mining tool for searching the Gene Expression Properties for genes of interest. Note that not all tools are compatible with all databases. | |
| Locus Select | This tool allows you to select a particular GeneID, motif analysis, and expression database. This allows comparison of the data mining tools to specific genes. | |
| MotifExpress | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. | |
| MotifCircadian | This tool searches for genes which have a large circadian amplitude, and returns motifs identified from that gene. | |
| MotifRanking | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. The user is able to select from the top 10 genes for a given property. Contributed by Mochizuki san. | |
| MotifQuery | This tool combines search criteria from several gene expression properties, to find genes with useful expression profiles. | |
| InputMotif | Since users my have prior knowledge of specific regulatory motifs, InputMotif allows users to input such data and use it for PromoterCAD designs. Use this if there is a particular motif you would like to add to your promoter design. You can continue to add motifs one at a time. | |
| Data Collection | Collection of Gene Expression Properties organized by type, such as tissues involved in the same organ (flowering), or data time courses taken in the same growth condition. | |
| Select Property | The Gene Expression Property used by the data mining Tool. This may be a raw data value, such as gene expression level at a certain time or place. It can also be a derived data value, such as the circadian amplitude of a gene in a certain condition. | |
| Base Sequence | The promoter sequence starts off as 500 blank base pairs. The downstream region has been fixed to 50 base-pairs taken from the Cauliflower Mosiac virus minimal promoter region. If you would like to add your own motifs at this point, you can place them manually in the sequence. You can also add your own motifs one at a time during the design process. The total sequence length is currently fixed to 500 base pairs. | |
| Database | Mashup of the Gene Expression Database (AtGenExpress, DIURNAL) and the Motif Regulation database (ATTED-II, PPDB). | |
| Select Range | Choose the phase of the circadian rhythm to search for. 0 hours is defined as the first night to day transition. The light cycle conditions will depend on the particular experiment. | |
| gacccttcctctatataaggaagttcatttcatttggagaggacctcgac | This is the minimal promoter element from the CaMV35S promoter. This sequence is fixed, but can be modified by forking the application. | |
| HanaDB | External data visualization by HanaDB, a database of plant tissue expression measurements, similar to AtGenExpress. This database also provides a picture representation of each plant tissue, with the gene expression level represented as a heat scale. | |
| eFP | External data visualization by the Arabidopsis eFP browser. This is a visualization of the AtGenExpress data, showing the gene expression level in different tissues as a heat scale. | PubMed:17684564 |
| Add Motifs | Add the motifs found from the data mining to the current promoter design. If you just want to add a single motif to the design, then enter the Advanced Motif View by clicking on a single motif in the alignment. You can also remove motifs from the alignment. | |
| Finish Now | Finish the promoter design by filling in the remaining sequence of the promoter. The last gene selected will be used, and its promoter sequence will be put in place in every position without a motif sequence. All motif sequences, as well as the 50 base-pair minimal promoter, will remain preserved. | |
| Next | Perform another data mining operation to find new motifs for the design. | |
| Start | Start your promoter design with the empty sequence in the region -51 to -550 from the transcriptional start site. | |
| Ranking | Ranking of gene loci giving the highest/lowest expression. | |
| Top/Bottom | If you select Top10, 10 gene loci giving the highest expression are listed. If Bottom10, loci giving the lowest expression are listed. | |
Masahiro Mochizuki
