Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information




Select a file name to see the detais.
Show API List
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://atted.jp/download.shtml
#license http://creativecommons.org/publicdomain/zero/1.0/deed.ja
#file_name tooltip_PromoterCAD_menus_buttons
#download_from http://linkdata.org/work/rdf1s915i
#namespace PubMed http://www.ncbi.nlm.nih.gov/pubmed/
#property explanation PubMed
#object_type_xsd string string
#property_context Assertion Assertion
Expression Database 4. Select the database Gene Atlas. -
Analysis Method 3. Select the analysis method PEDB -
Select Tool 2. First select the tool MotifExpress -
Locus Select This tool allows you to select a particular GeneID, motif analysis, and expression database. This allows comparison of the data mining tools to specific genes. -
MotifExpress This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. -
MotifCircadian This tool searches for genes which have a large circadian amplitude, and returns motifs identified from that gene. -
MotifRanking This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. The user is able to select from the top 10 genes for a given property. Contributed by Mochizuki san. -
MotifQuery This tool combines search criteria from several gene expression properties, to find genes with useful expression profiles. -
InputMotif Since users my have prior knowledge of specific regulatory motifs, InputMotif allows users to input such data and use it for PromoterCAD designs. Use this if there is a particular motif you would like to add to your promoter design. You can continue to add motifs one at a time. -
Data Collection 5. Select the data collection Myeloid_Leukocyte. \n Then, select the method " Max " . -
Select Property 6. Select a gene expression property such as mast_cells_IgE. & #13; & #13;7. PromoterCAD will find the gene with the highest expression in Myelod_Leukocyte cell types, return information about it, and show its predicted cis-regulatory motifs aligned with the empty promoter sequence. -
Base Sequence The promoter sequence starts off as 10000 blank base pairs. The downstream region has been fixed to 31 base-pairs taken from the cytomegalovirus (CMV) core promoter region. If you would like to add your own motifs at this point, you can place them manually in the sequence. You can also add your own motifs one at a time during the design process. The total sequence length is currently fixed to 1000 base pairs. -
Database Mashup of the Gene Expression Database (AtGenExpress, DIURNAL) and the Motif Regulation database (ATTED-II, PPDB). -
Select Range Choose the phase of the circadian rhythm to search for. 0 hours is defined as the first night to day transition. The light cycle conditions will depend on the particular experiment. -
aggtctatataagcagagctctctggctaac This is the minimal promoter element from the CMV promoter. This sequence is fixed, but can be modified by forking the application. PubMed:17331949
HanaDB External data visualization by HanaDB, a database of plant tissue expression measurements, similar to AtGenExpress. This database also provides a picture representation of each plant tissue, with the gene expression level represented as a heat scale. -
eFP External data visualization by the mouse eFP browser. This is a visualization of the mouse tissue atlas data, showing the gene expression level in different organs as a heat scale. PubMed:17684564
Add Motifs 8. Click " Add Motifs " to incoporate all of the gene's identified motifs into the promoter motif skeleton. -
Finish Now Now we fill in the skeleton (the 'bones' of the promoter, containing just regulatory motifs and the minimal promoter region) with the remaining sequence. -
Next 9. Click " Next " to start a new data mining step using the promoter skeleton you have constructed so far. -
Start 1. Start your promoter design with the empty sequence in the region -32 to -10031 from the transcriptional start site. -
* Row count is limited to 100.