Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Brain_Neural_tissues
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:amygdala label:cerebellum label:cerebral_cortex label:cerebral_cortex_prefrontal label:dorsal_root_ganglia label:dorsal_striatum label:hippocampus label:hypothalamus label:nucleus_accumbens label:olfactory_bulb label:spinal_cord
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 1464.85167 596.93923 911.05719 848.13055 488.52825 396.36375 722.44047 2064.0414 630.6757 796.16324 487.68935
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 298.29038 730.10168 669.66499 766.77142 2559.51731 1488.48954 204.00308 105.67697 783.49222 376.78991 168.0344
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 103.79138 4.63584 119.33562 139.4074 4.63584 119.82694 11.98733 11.90363 157.98198 923.7988 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 6844.38691 2610.71929 2927.30852 3105.16087 3573.0792 4765.87707 3864.76931 7820.05317 6212.25562 7111.488 5027.71923
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 459.23024 133.8272 283.51854 319.75523 384.4689 657.20539 243.79031 392.64953 523.86278 923.87976 299.1736
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 428.3066 548.62491 440.74871 372.08372 683.41919 661.25282 429.15369 924.73517 613.13363 632.1498 458.12002
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 135.72946 204.69065 128.49241 179.4525 231.98885 148.11806 86.03803 150.3069 153.05139 134.70955 137.13359
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 287.04446 135.58944 210.82961 254.35314 120.9518 134.88131 172.47447 285.40453 270.08787 154.3513 118.95672
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 50.34709 17.87488 43.62062 70.93302 452.96835 42.36135 41.32637 29.5331 23.09235 16.20574 23.93615
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 561.4265 987.11705 834.97096 814.3592 2367.64978 1330.99326 644.52084 1110.21808 837.47324 814.45427 1183.58607
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 156.4994 249.72696 216.56368 218.44419 220.86775 251.81871 101.97736 224.09425 175.83419 262.95323 136.6924
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 156.4994 249.72696 216.56368 218.44419 220.86775 251.81871 101.97736 224.09425 175.83419 262.95323 136.6924
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.84609 4.7398 4.84609 4.84609 4.84609 4.84609 4.88478 4.84609 4.80284 4.79997 4.86902
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 251.07546 340.26646 190.75677 200.90777 147.3323 382.73519 135.38532 161.97358 203.82107 224.84577 185.17901
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 12.82791 204.0047 7.47204 56.38169 4.63584 23.1096 81.48211 11.26659 24.45813 227.42577 32.70062
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 180.96808 104.77756 187.14573 187.94938 81.14329 541.55571 158.60539 187.65556 191.78583 120.71968 113.65041
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 102.81115 293.19146 132.71731 143.84247 6.26403 308.86787 152.15169 212.74825 47.28197 33.63006 621.82698
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 1188.86837 597.34492 624.36323 592.23987 600.5109 535.72124 715.34457 2086.89018 586.41969 740.24872 812.32273
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 41.13281 24.38698 17.13105 17.14906 43.55606 17.28685 20.57991 47.8438 44.90444 17.62979 20.50445
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 41.13281 24.38698 17.13105 17.14906 43.55606 17.28685 20.57991 47.8438 44.90444 17.62979 20.50445
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 515.39236 1141.91135 201.81679 341.99678 91.10082 57.08716 147.10552 580.25732 356.78036 42.85881 56.38513
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 208.10338 4.63584 93.73747 113.2402 16.21559 15.12402 65.07561 156.32626 42.57413 48.49465 142.3764
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 1319.71526 516.05159 533.87128 764.24196 3009.99603 2062.61193 534.47258 2411.17346 2306.86369 1693.30897 1567.9532
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 251.71912 252.0668 311.28956 280.89067 102.81601 257.91344 323.39935 186.73568 290.61134 339.62807 133.31285
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 304.85581 273.30485 263.64194 236.25184 417.17155 110.41356 214.21198 394.85101 116.6113 120.35375 204.90975
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 321.30288 153.29177 207.90802 245.68873 99.34534 291.73303 199.98777 325.31545 734.61784 288.7401 139.2318
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 1565.96831 1988.71999 1571.67854 1453.32309 4751.03343 1451.23263 1907.80134 3440.39066 1527.21811 1339.8375 5052.20549
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 4.7055 4.73219 4.6965 4.63584 4.6965 4.75796 4.63584 4.6965 4.71275 4.75796 4.63584
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 104.81414 204.70801 150.37197 161.07678 112.53097 121.98067 127.23424 131.88211 221.70856 275.20061 401.56954
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.63705 4.63584 4.63584 4.63584 4.63584 4.63804 4.63728 4.63584 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 18.3748 7.47965 6.13135 62.60904 7.33366 457.02624 9.3409 7.98013 1646.05723 19.97559 7.54826
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4498.64546 662.45722 2825.13328 2105.8346 784.14049 1785.05988 2372.02607 4385.8084 2676.47107 3022.40072 1024.10384
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63746 4.63584 4.63584 13.79942 4.9607 12.44208 4.63584 4.63584 111.31247 4.63584 4.63584
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 135.34801 174.91667 129.6155 96.50361 295.00988 262.45581 155.36018 172.9818 142.89682 133.54985 164.59572
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.74141 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 4176.59055 2110.98334 3254.47266 3374.91827 4429.72241 1679.74765 4078.75044 7093.71711 3475.1557 3967.55547 5385.67201
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 8.57076 8.57837 9.07022 8.44211 23.31452 8.67235 8.6316 8.6316 8.86442 7.76832 8.53633
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 4.63584 4.63952 4.63584 4.63584 4.63584 4.63584 4.73012 4.66233 4.74964 4.71054 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 63.357 14.8257 72.16418 85.1577 209.54033 500.41812 27.66926 24.60859 149.99535 17.96898 14.14817
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 4516.8066 4183.93425 4895.43429 4947.96357 3253.64066 3706.97006 4257.7362 5284.71641 4536.70531 5395.93693 5110.81055
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 131.6646 100.25462 342.18083 245.92027 34.58249 214.43429 108.3279 88.42099 210.91626 83.74117 38.28249
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 15323.7206 14278.64847 19327.30713 20580.47363 10290.71277 20275.46832 15660.62357 15817.21597 12700.19272 15608.72204 22307.43164
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 120.41234 4.87849 14.05884 23.94346 28.81941 36.39051 35.35627 11.02363 20.52549 17.00711 22.61875
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 4995.47574 2798.34548 4870.78124 4201.88571 2625.78542 7614.54834 4260.60894 9401.08499 8169.42374 8159.06166 8308.02739
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63693 4.63584 4.63584 4.63584 4.63974 4.97869 4.69725 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 132.1283 121.71396 239.26869 208.07353 116.7659 65.80745 108.93127 97.56321 128.70399 456.52899 104.01442
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 5.15746 7.58465 6.27031 5.70129 185.7451 6.32552 7.21235 6.65206 7.86472 7.27794 42.58598
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 104.54267 26.17856 40.49386 37.01201 53.54518 49.253 355.87774 131.04398 59.55593 84.00981 81.36207
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 4.63584 5.32465 31.68679 13.97244 4.63584 4.63584 6.21783 4.63584 4.63584 5.05467 6.07426
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.03194 4.77185 4.63584 4.63584 4.63584
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 3930.11165 6024.08259 4569.94118 3823.23733 3996.36351 3945.35261 4578.21881 4523.17751 4881.01872 6673.51628 6684.3657
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 12.21006 6.15283 6.1316 5.80137 8.56683 5.89493 9.66594 6.46735 6.17693 13.50239 5.9681
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 52.37126 64.02217 61.07309 86.41488 78.05859 171.29747 41.18164 54.53122 102.68813 58.81206 43.24282
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 663.83339 332.398 481.74952 562.82567 163.66963 880.82933 407.44554 524.74051 566.09393 730.64265 304.19874
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 235.58697 428.90198 273.97817 305.89121 1034.09574 662.7483 225.96703 200.82313 412.47441 121.6877 799.77373
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 76.77057 12.72122 85.53413 60.13343 28.56958 20.63569 34.41866 26.54474 15.72962 101.37926 11.12244
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 54.28358 419.8357 32.87681 61.41978 4.89626 223.26682 13.03812 22.66488 166.66762 4.88333 22.30173
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 281.62364 624.24814 273.84204 259.75466 99.96244 369.76156 273.38147 353.69799 405.76399 380.04909 129.71687
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 281.62364 624.24814 273.84204 259.75466 99.96244 369.76156 273.38147 353.69799 405.76399 380.04909 129.71687
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 6.14789 9.97322 6.14789 6.07083 5.71826 6.69852 23.42609 6.10301 6.29452 5.30977 6.14789
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 20.50349 18.45016 11.29922 21.25924 41.28603 20.84871 24.05527 21.46915 24.72519 14.85045 28.59935
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 53.21901 44.8696 58.16481 84.04116 55.20418 66.55966 128.47594 56.44941 34.93243 84.85985 66.20453
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 53.21901 44.8696 58.16481 84.04116 55.20418 66.55966 128.47594 56.44941 34.93243 84.85985 66.20453
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 2926.24768 4973.22215 3716.42828 3356.00213 3281.61964 4483.59742 2436.14067 4115.26022 5356.6467 3266.09283 2128.71337
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 926.88665 5.87885 75.02529 136.47244 7.06381 69.02988 103.1429 49.55012 231.07551 5.10934 17.32787
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 530.16061 397.96936 360.38325 444.13269 371.36358 611.81766 407.59455 569.06097 447.3122 383.8266 253.37775
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 31.47193 91.75344 49.9434 65.29967 6.72923 59.77709 15.62113 49.9007 87.23718 59.12159 23.47912
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 141.49885 302.87326 216.34753 152.39016 426.71979 130.49511 148.21305 315.32736 169.4512 223.32291 516.47903
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 6.06856 6.85901 5.79852 6.08642 5.64434 14.0431 7.62954 6.12706 5.68166 5.64434 8.8961
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 22.09073 12.29236 13.83984 11.47711 11.71614 8.88552 14.76862 16.70986 8.28043 13.11837 25.80814
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.21443 5.21443 5.21443 5.21443 4.91663 5.22063 5.21443 6.52035 5.21443 5.21443 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 15109.00914 1360.47929 19031.70608 16555.2914 1446.28586 19390.80808 20502.83147 3517.15258 13119.08195 3229.48288 2193.19851
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 3197.4384 6208.67089 4032.12824 3896.54059 3014.17424 3893.06572 3430.29077 3961.55198 3316.24598 3581.96207 2914.80232
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 177.54193 54.68025 24.90869 66.55373 476.65333 274.91716 218.2914 392.39913 246.383 62.6067 60.45079
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 10.66831 12.47755 12.2284 8.72695 12.98481 9.55378 12.01499 7.49026 11.77976 12.90922 12.2284
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 15.3528 6.3327 8.73747 13.61677 7.17419 9.24218 55.12871 8.99185 8.21164 7.58344 11.47742
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 4.68228 4.75518 7.03245 4.80231 4.659 5.0117 4.83059 4.68228 5.90508 4.68228 4.70142
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 20.84874 15.334 30.65886 31.21313 30.47862 18.14253 28.67919 10.19223 8.83369 15.12517 24.36278
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 4.63584 4.63584 4.63584 5.89436 4.63584 4.63584 4.64236 4.63584 4.63584
* Row count is limited to 100.