Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Spleen_Lymph_node
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:bone label:bone_marrow label:lymph_nodes label:spleen
#object_type_xsd string string string float string string integer integer integer string string string string float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 92.96687 16.34339 639.66487 19.83543
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 1297.88587 1031.32419 1536.89876 1461.25325
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.67306 4.63584 4.63584 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 702.65166 720.78999 340.07151 389.61956
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 3436.62762 4332.72249 265.77733 306.35134
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 1277.03889 1178.72661 1577.00994 1542.22405
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 474.3013 615.29508 412.92573 198.43567
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 45.65864 92.446 186.51724 220.30168
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 3356.80036 3611.07867 1199.70744 1254.40961
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 4233.52604 4354.12872 7696.66134 6733.30295
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 264.44438 365.37622 291.19662 229.02144
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 264.44438 365.37622 291.19662 229.02144
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.87403 4.84609 4.84609 4.85371
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 691.69798 675.04997 389.9619 460.60878
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 4.63584 4.63584
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 67.73595 52.20274 39.72415 80.09023
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 8.44997 6.26403 133.09545 11.12185
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 22.56097 9.55589 31.06856 18.66512
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.68679 5.38819 9.36194 6.91744
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.68679 5.38819 9.36194 6.91744
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 4.81824 4.82624 4.81824 4.82624
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 5.22086 5.12993 5.44757 1166.93439
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 180.41234 184.2141 393.65376 312.38217
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 431.24074 423.94573 554.44688 458.54084
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 34.17599 32.50598 45.61193 45.11216
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 1494.64665 1981.06812 438.55855 585.31368
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 9.31501 15.5252 26.38163 7.22564
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 332.16435 487.19347 735.39135 1177.04377
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.71805 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 12.29557 7.23984 7.12167 7.35997
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.88118 4.86452 26.67714 4.86452
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63584 4.67099 7.66454 4.64064
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 1490.78083 1443.48232 1917.38326 1151.23973
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 495.70548 76.41819 79.79943 50.57392
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 5.11675 4.82615 4.7397 4.96812
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 5.11675 4.82615 4.7397 4.96812
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 5.11675 4.82615 4.7397 4.96812
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 60.01984 91.49554 10.98157 12.35887
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 4.63584 4.63584 4.63584 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 93.92034 6.46018 44.4151 9.06943
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 10975.24509 12960.56907 11657.68664 10686.0922
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 10.48818 8.64633 8.03898 10.01523
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 10.48818 8.64633 8.03898 10.01523
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 10.48818 8.64633 8.03898 10.01523
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 38.31613 25.21864 19.1652 22.7798
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 14833.74052 11657.49578 10920.03539 8850.85268
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 11042.76541 9446.93147 21517.04636 22546.20245
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 8225.13682 4728.8269 65.05766 219.44025
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 4.70354 4.63584 4.66318
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 57.26825 59.93775 65.30195 99.03649
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 19.49332 29.35128 24.7974 146.70556
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 36.35119 6.73115 11.49933 9.605
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 4.63584 4.63584 4.63584 4.63584
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 5.1014 444.14952 160.36864
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 3269.66545 2488.95413 3092.15688 3083.77913
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 5.94068 5.44406 5.60848 5.2425
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 150.12076 139.69248 102.46737 123.99065
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 429.66684 424.99383 354.093 352.66119
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 4.94656 4.88394 25.38718 31.18626
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 4.63584 4.63584 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 4.63584 4.63584 4.63584 4.63584
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 685.18784 627.01596 282.32984 299.01469
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 685.18784 627.01596 282.32984 299.01469
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 8.37907 6.14789 5.05037 6.06952
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 21.52257 25.14663 26.08104 19.12911
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 57.35798 34.97473 58.17563 28.02865
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 57.35798 34.97473 58.17563 28.02865
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 4779.02597 4637.34869 6395.10653 7149.13016
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 6.07509 4.64697 4.64697 4.64697
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 319.94915 281.80058 240.59147 278.7057
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.68056 4.63584 4.83485
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 1528.94635 2274.4774 555.31499 658.4029
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 5.64434 5.64434 5.64434 5.30404
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 15.44852 19.91704 22.56114 14.84883
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.21443 5.21443 7.50414 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 94.32774 8.13847 9.89198 8.13102
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 8608.59848 7629.15487 6486.28593 6997.43846
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 78.11426 307.7247 600.31336 127.26403
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 813.08419 1199.37629 210.79156 91.88965
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 110.23925 86.78879 11.79916 9.48741
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 69.95978 99.68403 564.93866 563.20016
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 98.48928 177.57409 27.16114 33.04618
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 15.14747 14.08616
* Row count is limited to 100.