Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

PEDB motif - Gene Atlas mashup table

Open Smart Phone View

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
Show API List
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Lymphocytes
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:B-cells_GL7_negative_KLH label:B-cells_GL7_positive_Alum label:B-cells_GL7_positive_KLH label:B-cells_GL7negative_Alum label:B-cells_marginal_zone label:Baf3 label:NK_cells label:T-cells_CD4+ label:T-cells_CD8+ label:T-cells_foxP3+ label:follicular_B-cells label:thymocyte_DP_CD4+CD8+ label:thymocyte_SP_CD4+ label:thymocyte_SP_CD8+
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 7.89393 7.4272 7.42492 8.22988 6.95234 7.4272 52.59532 13.34622 23.55576 43.47279 7.90476 10.61392 45.16377 150.48376
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 1049.16607 958.65096 827.07578 1087.59526 948.59034 1259.53834 2852.35125 2234.41437 2115.50336 1541.60222 1449.30009 1750.58762 1671.03248 2429.11001
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.78166 4.63584 4.63584 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 258.26399 280.49077 193.70906 248.3687 93.46019 2711.38184 409.7637 362.6339 326.3912 440.32987 163.10371 612.97486 514.28031 586.04496
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 132.41773 187.21349 109.25421 178.95076 61.73436 2479.97231 164.16625 97.35515 87.12671 179.43845 78.85179 1464.19092 260.75834 776.29616
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 1356.83103 1525.74681 1386.10274 1355.84549 1916.45551 1584.07273 3308.03395 1327.67289 1331.81858 1479.16424 1676.73985 243.22682 638.4199 789.54488
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 401.31523 452.46709 361.32104 460.65844 384.66748 350.96849 388.65571 292.57549 320.47517 289.35077 402.39066 290.9517 241.31724 309.132
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 124.85268 218.06628 137.57814 163.30425 70.57989 4752.9565 203.55546 138.48853 387.37924 55.77077 318.6737 22.05977 114.4444 305.7698
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 1712.99063 2156.50145 1809.5853 2012.66111 1063.78414 5692.10748 2131.59621 645.88946 766.12194 2017.03753 2145.74148 699.52323 440.82381 740.91408
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 1224.80671 1385.79423 1025.76046 1863.38571 710.24281 2400.59771 2213.25869 964.39638 658.98956 1228.87511 4064.75612 517.16492 1088.31289 661.46274
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 861.70339 844.29389 841.64298 914.02963 753.12124 291.4712 1444.67266 799.64095 707.33378 943.06533 438.72055 464.47131 721.99913 656.48984
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 861.70339 844.29389 841.64298 914.02963 753.12124 291.4712 1444.67266 799.64095 707.33378 943.06533 438.72055 464.47131 721.99913 656.48984
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 5.46786 5.07918 5.58392 4.84609 6.29972 4.84609 4.84609 10.94081 7.48595 4.84609 4.84609 5.36386 6.583 8.39779
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 1012.25233 966.40272 948.61661 1028.09329 791.71675 483.68005 972.03673 685.67724 706.8978 499.52497 909.16388 965.74241 602.87628 761.87481
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.79309 4.63584 4.63584 4.63584 4.63584 5.11289 4.63584 4.63584
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 293.29608 209.7372 167.92975 304.24316 242.46724 54.64183 93.31785 190.54343 220.57902 150.91328 74.78757 210.69523 199.54085 172.03777
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 5.38879 4.85697 6.26403 4.84197 5.05726 6.26403 200.37742 8.01386 6.31041 6.26403 5.6284 12.12119 159.63776 45.34688
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 6.47785 6.32735 5.77619 10.31667 13.29653 5.56981 14.46063 4.65326 6.93229 10.14407 7.88509 4.94474 10.2716 5.30212
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 5.80242 4.63584 5.38819 4.63584 5.17907 5.38819 5.22276 5.38819 5.56117 6.26264 4.85033 5.74605 5.1348 5.54846
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 5.80242 4.63584 5.38819 4.63584 5.17907 5.38819 5.22276 5.38819 5.56117 6.26264 4.85033 5.74605 5.1348 5.54846
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 4.82624 4.82624 4.82193 4.81824 4.82193 4.81393 5.71451 4.81824 4.82624 5.45164 4.82624 78.14824 6.37234 50.32176
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.85365 4.63584 4.63584 4.63584 6.99176 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 5.33163 5.12993 5.75313 5.33163 450.12366 5.42223 34.51106 5.33163 5.35274 5.49508 5.45667 6.22497 5.39668 5.33163
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 117.5864 115.85567 82.8718 153.18642 79.98106 334.72315 527.26526 109.89075 123.4694 87.70833 242.92915 116.03195 60.17273 98.30039
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 781.63024 1026.05642 1032.18286 920.03721 687.58703 501.67306 1355.07003 1472.19772 1420.59155 1624.03256 978.16586 701.43536 1032.48319 1069.59855
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 36.98872 39.30212 33.96861 56.55081 37.89584 55.00663 24.31045 31.88591 30.51914 24.76356 44.80217 34.65053 33.79125 31.53914
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 307.97135 358.29384 205.46616 380.03767 122.71324 1170.0358 181.27837 95.55644 161.30954 161.23382 662.00816 73.98788 22.75697 77.1365
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 4.6965 4.6965 5.99117 4.63584 5.33908 5.33908 5.99117 69.10097 29.564 6.73728 5.33908 17.20047 48.3087 9.13979
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 458.8985 581.74105 601.18088 469.46103 517.96094 229.65781 1342.3388 796.18349 692.54822 884.26688 982.45701 406.2249 390.39052 266.4108
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.63584 4.63584 4.76234 4.63584 4.63584 4.63584 4.63584 5.17912 4.63584 4.83687 4.63584 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 7.98013 7.60838 8.80477 7.96634 9.41928 7.95334 15.20802 7.66378 7.98013 7.66378 7.66378 7.35997 7.35997 17.29546
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.86452 5.14839 4.7488 4.86452 4.76429 4.76429 6.17708 4.86452 4.86452 4.86452 4.76429 4.86452 4.86452 4.86452
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63584 4.63584 4.63584 4.63584 4.63584 5.49405 4.88036 5.03884 4.69063 9.00817 5.58741 4.63584 6.20591 6.30311
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 904.85382 938.17903 806.46526 1056.05071 852.34523 798.6086 2779.01204 1337.20455 1303.03367 1311.17101 1618.76123 756.83532 991.78168 1092.02568
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.0614 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 7.3683 5.54932 6.94442 17.11864 160.10769 4269.70801 32.45824 5.57424 4.63584 15.07468 6.19217 5.07206 4.82208 4.96776
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 10.64303 12.4811 14.80155 9.60032 9.07022 8.53633 12.71284 8.59382 8.50975 13.87701 7.72704 8.79862 7.72704 7.84374
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 5.92374 6.25582 4.63584 8.37725 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.3515 4.91684 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 5.10788 5.23503 4.92634 5.12135 4.99795 5.38834 5.23503 5.31114 4.63584 8.01026 5.38834 5.31114 4.63584 5.23503
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 1957.56013 4141.66579 3738.30113 3290.67722 2699.22163 19299.80606 1055.34229 5064.84749 5720.23314 4500.4531 14149.63215 6919.54945 5620.36794 11993.87972
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 41.84985 27.48047 45.07877 46.74533 18.82122 33.47157 44.50277 15.55054 16.90214 15.55054 42.13149 12.42256 15.55054 14.20844
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 10864.02103 9151.31885 10352.55837 12337.76819 8115.88171 12454.51241 20912.30779 12408.91572 10846.92265 12789.01068 8118.89747 9694.9617 12753.39679 14151.59402
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 16976.61792 15823.88034 14451.76062 17947.58381 14036.55371 7334.7129 49316.7998 21461.37449 19784.97561 21387.30691 26740.72732 17295.15821 16951.10341 17805.90792
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 75.42687 71.47766 19.68951 152.10888 770.66174 7.3714 106.02786 17.53913 10.72055 49.48742 6.64668 178.4075 217.10577 50.01982
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 21.97 34.50662 24.72066 27.28826 39.66114 109.15503 52.07351 81.56892 117.0449 70.93091 44.58975 49.23906 49.94963 81.7808
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 5.55408 7.41338 7.83185 6.60976 27.13601 7.92871 11.49355 7.39965 5.86236 7.92871 7.78371 9.17806 8.33817 6.65206
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 10.46187 14.00285 16.27247 9.7903 7.96449 6.34193 10.17153 14.21641 12.71361 6.94775 11.44113 6.95104 7.8649 10.72429
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 9.98908 14.31329 52.49471 5.0591 9.88885 4.63584 4.63584 5.816 5.82948 7.12664 12.34187 4.63584 13.65701 7.31771
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 6.21458 6.61303 5.16477 5.66903 4.82569 4.63584 306.4152 795.02012 789.68941 418.14061 4.63584 385.73397 501.82303 523.75982
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 1750.21923 2153.13742 1611.09353 1725.80456 1075.93522 3891.06005 1527.78994 2136.2667 2425.95552 1631.27616 2540.17329 3209.464 2157.24007 2840.16844
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 6.54627 8.72169 8.59188 6.01442 16.293 5.65559 8.74082 6.31516 7.22172 6.98193 6.01442 6.01442 7.31643 6.59126
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 149.77936 181.31866 208.06276 219.91761 375.02774 69.81686 358.52625 188.35237 189.22048 324.83122 334.74661 177.27133 298.50284 203.61217
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 421.79013 263.05317 211.88073 387.801 307.86833 232.83368 439.87025 533.16909 412.93771 392.04775 188.95247 181.30271 441.23773 327.4289
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 4.94656 4.79056 4.82591 4.88778 4.72992 4.72992 4.72992 4.82591 4.88394 4.88394 4.90054 4.9138 4.82591 4.72992
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 6.5618 4.63584 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 4.63584 5.13213 4.63584 4.63584 4.9663 4.63584 4.82492 5.26522 4.63584 4.8333 4.63584 4.63584 4.63584 4.63584
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 199.2992 336.18065 501.0307 240.3578 386.0779 694.85642 136.79547 203.63038 163.76559 220.34869 365.36509 122.68262 151.01404 146.64161
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 199.2992 336.18065 501.0307 240.3578 386.0779 694.85642 136.79547 203.63038 163.76559 220.34869 365.36509 122.68262 151.01404 146.64161
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 10.07558 10.89231 8.98864 7.93892 22.43919 6.06952 8.71093 6.14789 12.4758 8.18002 6.51632 8.51753 8.13735 8.49109
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 31.17529 31.17529 26.25803 31.17529 30.41141 42.7527 22.55026 31.17529 31.95837 27.46522 31.95837 39.66404 31.17529 31.17529
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 31.89983 34.63954 44.04005 35.52441 28.74083 12.23577 26.67119 8.37958 12.89057 20.76419 21.35012 12.4325 10.08689 9.01343
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 31.89983 34.63954 44.04005 35.52441 28.74083 12.23577 26.67119 8.37958 12.89057 20.76419 21.35012 12.4325 10.08689 9.01343
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 4106.62382 3992.40288 4398.03256 5066.06363 6152.8577 4522.7895 11616.19159 5138.32942 4356.97073 5923.08233 7210.15477 3177.39087 3326.28981 3271.28582
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.64697 4.64697 4.64697 4.64697 4.64697 5.42206 4.64697 4.64697 4.64697 4.64697 5.2049 4.64697 4.64697 5.29263
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 447.47222 354.81005 288.39798 440.0223 272.28258 408.25969 551.95277 489.61065 485.19536 432.82482 355.77652 145.81795 274.64708 457.84035
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.78353 4.63584 4.63584
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 327.38915 389.3119 394.00903 420.56658 264.86342 1092.22392 451.8661 472.18625 303.68534 427.46059 254.32997 839.04676 335.98971 378.7661
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 5.64434 5.79477 5.64434 5.94572 7.78948 5.64434 5.80427 5.64434 5.64434 5.64434 5.64434 6.08023 6.92994 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 67.00829 106.0863 85.16214 98.72304 11.28683 8.88552 9.69621 14.42887 15.75895 13.72444 19.20455 328.03768 189.28805 189.68132
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 8.07257 7.59162 9.43152 6.61145 8.59547 10.05624 7.23127 5.62923 5.2946 4.8407 9.66535 6.57438 4.79031 5.7192
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 5683.79868 6799.5812 6304.86543 6377.96982 6239.67653 8523.73373 14494.94918 9730.80698 7822.90846 8988.97819 7134.38039 8381.12133 8552.83017 10009.2306
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 31.19276 18.45298 17.92859 24.41542 13.91725 34.01686 21.56161 634.61899 247.57294 427.54965 90.08897 47.46609 219.4327 122.77168
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 32.83227 103.98947 162.0441 40.98723 68.11742 1204.21752 576.4739 30.33875 52.44224 570.8098 13.46408 1961.63054 104.68936 536.46681
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 12.04525 8.77742 9.3748 12.99236 13.60912 7.6983 10.68599 26.40281 9.6632 134.25075 7.73621 184.693 85.35492 41.44955
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 465.40699 824.08779 1152.31822 466.74553 154.13178 6.5801 441.96222 247.56317 287.83096 311.23869 1864.38559 50.6616 153.26066 187.60087
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 29.65251 37.04671 29.65251 30.65886 36.4694 45.35987 29.05055 16.40026 31.66008 19.42014 33.10855 46.91171 44.75541 70.48463
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 5.1678 4.63584 4.75664 4.63584 4.63584 4.63584 7.02071 4.63584 4.63584 4.63584 4.63584 4.63584
* Row count is limited to 100.