Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Lymphocytes
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:B-cells_GL7_negative_KLH label:B-cells_GL7_positive_Alum label:B-cells_GL7_positive_KLH label:B-cells_GL7negative_Alum label:B-cells_marginal_zone label:Baf3 label:NK_cells label:T-cells_CD4+ label:T-cells_CD8+ label:T-cells_foxP3+ label:follicular_B-cells label:thymocyte_DP_CD4+CD8+ label:thymocyte_SP_CD4+ label:thymocyte_SP_CD8+
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 7.89393 7.4272 7.42492 8.22988 6.95234 7.4272 52.59532 13.34622 23.55576 43.47279 7.90476 10.61392 45.16377 150.48376
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 1049.16607 958.65096 827.07578 1087.59526 948.59034 1259.53834 2852.35125 2234.41437 2115.50336 1541.60222 1449.30009 1750.58762 1671.03248 2429.11001
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.78166 4.63584 4.63584 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 258.26399 280.49077 193.70906 248.3687 93.46019 2711.38184 409.7637 362.6339 326.3912 440.32987 163.10371 612.97486 514.28031 586.04496
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 132.41773 187.21349 109.25421 178.95076 61.73436 2479.97231 164.16625 97.35515 87.12671 179.43845 78.85179 1464.19092 260.75834 776.29616
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 1356.83103 1525.74681 1386.10274 1355.84549 1916.45551 1584.07273 3308.03395 1327.67289 1331.81858 1479.16424 1676.73985 243.22682 638.4199 789.54488
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 401.31523 452.46709 361.32104 460.65844 384.66748 350.96849 388.65571 292.57549 320.47517 289.35077 402.39066 290.9517 241.31724 309.132
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 124.85268 218.06628 137.57814 163.30425 70.57989 4752.9565 203.55546 138.48853 387.37924 55.77077 318.6737 22.05977 114.4444 305.7698
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 1712.99063 2156.50145 1809.5853 2012.66111 1063.78414 5692.10748 2131.59621 645.88946 766.12194 2017.03753 2145.74148 699.52323 440.82381 740.91408
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 1224.80671 1385.79423 1025.76046 1863.38571 710.24281 2400.59771 2213.25869 964.39638 658.98956 1228.87511 4064.75612 517.16492 1088.31289 661.46274
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 861.70339 844.29389 841.64298 914.02963 753.12124 291.4712 1444.67266 799.64095 707.33378 943.06533 438.72055 464.47131 721.99913 656.48984
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 861.70339 844.29389 841.64298 914.02963 753.12124 291.4712 1444.67266 799.64095 707.33378 943.06533 438.72055 464.47131 721.99913 656.48984
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 5.46786 5.07918 5.58392 4.84609 6.29972 4.84609 4.84609 10.94081 7.48595 4.84609 4.84609 5.36386 6.583 8.39779
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 1012.25233 966.40272 948.61661 1028.09329 791.71675 483.68005 972.03673 685.67724 706.8978 499.52497 909.16388 965.74241 602.87628 761.87481
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.79309 4.63584 4.63584 4.63584 4.63584 5.11289 4.63584 4.63584
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 293.29608 209.7372 167.92975 304.24316 242.46724 54.64183 93.31785 190.54343 220.57902 150.91328 74.78757 210.69523 199.54085 172.03777
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 5.38879 4.85697 6.26403 4.84197 5.05726 6.26403 200.37742 8.01386 6.31041 6.26403 5.6284 12.12119 159.63776 45.34688
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 6.47785 6.32735 5.77619 10.31667 13.29653 5.56981 14.46063 4.65326 6.93229 10.14407 7.88509 4.94474 10.2716 5.30212
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 5.80242 4.63584 5.38819 4.63584 5.17907 5.38819 5.22276 5.38819 5.56117 6.26264 4.85033 5.74605 5.1348 5.54846
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 5.80242 4.63584 5.38819 4.63584 5.17907 5.38819 5.22276 5.38819 5.56117 6.26264 4.85033 5.74605 5.1348 5.54846
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 4.82624 4.82624 4.82193 4.81824 4.82193 4.81393 5.71451 4.81824 4.82624 5.45164 4.82624 78.14824 6.37234 50.32176
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.85365 4.63584 4.63584 4.63584 6.99176 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 5.33163 5.12993 5.75313 5.33163 450.12366 5.42223 34.51106 5.33163 5.35274 5.49508 5.45667 6.22497 5.39668 5.33163
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 117.5864 115.85567 82.8718 153.18642 79.98106 334.72315 527.26526 109.89075 123.4694 87.70833 242.92915 116.03195 60.17273 98.30039
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 781.63024 1026.05642 1032.18286 920.03721 687.58703 501.67306 1355.07003 1472.19772 1420.59155 1624.03256 978.16586 701.43536 1032.48319 1069.59855
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 36.98872 39.30212 33.96861 56.55081 37.89584 55.00663 24.31045 31.88591 30.51914 24.76356 44.80217 34.65053 33.79125 31.53914
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 307.97135 358.29384 205.46616 380.03767 122.71324 1170.0358 181.27837 95.55644 161.30954 161.23382 662.00816 73.98788 22.75697 77.1365
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 4.6965 4.6965 5.99117 4.63584 5.33908 5.33908 5.99117 69.10097 29.564 6.73728 5.33908 17.20047 48.3087 9.13979
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 458.8985 581.74105 601.18088 469.46103 517.96094 229.65781 1342.3388 796.18349 692.54822 884.26688 982.45701 406.2249 390.39052 266.4108
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.63584 4.63584 4.76234 4.63584 4.63584 4.63584 4.63584 5.17912 4.63584 4.83687 4.63584 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 7.98013 7.60838 8.80477 7.96634 9.41928 7.95334 15.20802 7.66378 7.98013 7.66378 7.66378 7.35997 7.35997 17.29546
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.86452 5.14839 4.7488 4.86452 4.76429 4.76429 6.17708 4.86452 4.86452 4.86452 4.76429 4.86452 4.86452 4.86452
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63584 4.63584 4.63584 4.63584 4.63584 5.49405 4.88036 5.03884 4.69063 9.00817 5.58741 4.63584 6.20591 6.30311
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 904.85382 938.17903 806.46526 1056.05071 852.34523 798.6086 2779.01204 1337.20455 1303.03367 1311.17101 1618.76123 756.83532 991.78168 1092.02568
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.0614 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 7.3683 5.54932 6.94442 17.11864 160.10769 4269.70801 32.45824 5.57424 4.63584 15.07468 6.19217 5.07206 4.82208 4.96776
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.76011 4.63584 4.63584 5.20944 4.63584 4.63584 5.12613 4.63584 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 10.64303 12.4811 14.80155 9.60032 9.07022 8.53633 12.71284 8.59382 8.50975 13.87701 7.72704 8.79862 7.72704 7.84374
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 5.92374 6.25582 4.63584 8.37725 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.3515 4.91684 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 5.10788 5.23503 4.92634 5.12135 4.99795 5.38834 5.23503 5.31114 4.63584 8.01026 5.38834 5.31114 4.63584 5.23503
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 1957.56013 4141.66579 3738.30113 3290.67722 2699.22163 19299.80606 1055.34229 5064.84749 5720.23314 4500.4531 14149.63215 6919.54945 5620.36794 11993.87972
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 7.8162 6.7511 7.8162 6.33111 8.17209 8.42789 8.64633 8.42789 9.29614 8.64633 8.51554 13.29348 8.98101 8.72993
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 41.84985 27.48047 45.07877 46.74533 18.82122 33.47157 44.50277 15.55054 16.90214 15.55054 42.13149 12.42256 15.55054 14.20844
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 10864.02103 9151.31885 10352.55837 12337.76819 8115.88171 12454.51241 20912.30779 12408.91572 10846.92265 12789.01068 8118.89747 9694.9617 12753.39679 14151.59402
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 16976.61792 15823.88034 14451.76062 17947.58381 14036.55371 7334.7129 49316.7998 21461.37449 19784.97561 21387.30691 26740.72732 17295.15821 16951.10341 17805.90792
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 75.42687 71.47766 19.68951 152.10888 770.66174 7.3714 106.02786 17.53913 10.72055 49.48742 6.64668 178.4075 217.10577 50.01982
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 21.97 34.50662 24.72066 27.28826 39.66114 109.15503 52.07351 81.56892 117.0449 70.93091 44.58975 49.23906 49.94963 81.7808
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 5.55408 7.41338 7.83185 6.60976 27.13601 7.92871 11.49355 7.39965 5.86236 7.92871 7.78371 9.17806 8.33817 6.65206
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 10.46187 14.00285 16.27247 9.7903 7.96449 6.34193 10.17153 14.21641 12.71361 6.94775 11.44113 6.95104 7.8649 10.72429
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 9.98908 14.31329 52.49471 5.0591 9.88885 4.63584 4.63584 5.816 5.82948 7.12664 12.34187 4.63584 13.65701 7.31771
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 6.21458 6.61303 5.16477 5.66903 4.82569 4.63584 306.4152 795.02012 789.68941 418.14061 4.63584 385.73397 501.82303 523.75982
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 1750.21923 2153.13742 1611.09353 1725.80456 1075.93522 3891.06005 1527.78994 2136.2667 2425.95552 1631.27616 2540.17329 3209.464 2157.24007 2840.16844
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 6.54627 8.72169 8.59188 6.01442 16.293 5.65559 8.74082 6.31516 7.22172 6.98193 6.01442 6.01442 7.31643 6.59126
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 149.77936 181.31866 208.06276 219.91761 375.02774 69.81686 358.52625 188.35237 189.22048 324.83122 334.74661 177.27133 298.50284 203.61217
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 421.79013 263.05317 211.88073 387.801 307.86833 232.83368 439.87025 533.16909 412.93771 392.04775 188.95247 181.30271 441.23773 327.4289
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 4.94656 4.79056 4.82591 4.88778 4.72992 4.72992 4.72992 4.82591 4.88394 4.88394 4.90054 4.9138 4.82591 4.72992
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 6.5618 4.63584 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 4.63584 5.13213 4.63584 4.63584 4.9663 4.63584 4.82492 5.26522 4.63584 4.8333 4.63584 4.63584 4.63584 4.63584
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 199.2992 336.18065 501.0307 240.3578 386.0779 694.85642 136.79547 203.63038 163.76559 220.34869 365.36509 122.68262 151.01404 146.64161
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 199.2992 336.18065 501.0307 240.3578 386.0779 694.85642 136.79547 203.63038 163.76559 220.34869 365.36509 122.68262 151.01404 146.64161
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 10.07558 10.89231 8.98864 7.93892 22.43919 6.06952 8.71093 6.14789 12.4758 8.18002 6.51632 8.51753 8.13735 8.49109
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 31.17529 31.17529 26.25803 31.17529 30.41141 42.7527 22.55026 31.17529 31.95837 27.46522 31.95837 39.66404 31.17529 31.17529
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 31.89983 34.63954 44.04005 35.52441 28.74083 12.23577 26.67119 8.37958 12.89057 20.76419 21.35012 12.4325 10.08689 9.01343
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 31.89983 34.63954 44.04005 35.52441 28.74083 12.23577 26.67119 8.37958 12.89057 20.76419 21.35012 12.4325 10.08689 9.01343
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 4106.62382 3992.40288 4398.03256 5066.06363 6152.8577 4522.7895 11616.19159 5138.32942 4356.97073 5923.08233 7210.15477 3177.39087 3326.28981 3271.28582
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.64697 4.64697 4.64697 4.64697 4.64697 5.42206 4.64697 4.64697 4.64697 4.64697 5.2049 4.64697 4.64697 5.29263
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 447.47222 354.81005 288.39798 440.0223 272.28258 408.25969 551.95277 489.61065 485.19536 432.82482 355.77652 145.81795 274.64708 457.84035
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.78353 4.63584 4.63584
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 327.38915 389.3119 394.00903 420.56658 264.86342 1092.22392 451.8661 472.18625 303.68534 427.46059 254.32997 839.04676 335.98971 378.7661
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 5.64434 5.79477 5.64434 5.94572 7.78948 5.64434 5.80427 5.64434 5.64434 5.64434 5.64434 6.08023 6.92994 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 67.00829 106.0863 85.16214 98.72304 11.28683 8.88552 9.69621 14.42887 15.75895 13.72444 19.20455 328.03768 189.28805 189.68132
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 8.07257 7.59162 9.43152 6.61145 8.59547 10.05624 7.23127 5.62923 5.2946 4.8407 9.66535 6.57438 4.79031 5.7192
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 5683.79868 6799.5812 6304.86543 6377.96982 6239.67653 8523.73373 14494.94918 9730.80698 7822.90846 8988.97819 7134.38039 8381.12133 8552.83017 10009.2306
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 31.19276 18.45298 17.92859 24.41542 13.91725 34.01686 21.56161 634.61899 247.57294 427.54965 90.08897 47.46609 219.4327 122.77168
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 32.83227 103.98947 162.0441 40.98723 68.11742 1204.21752 576.4739 30.33875 52.44224 570.8098 13.46408 1961.63054 104.68936 536.46681
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 12.04525 8.77742 9.3748 12.99236 13.60912 7.6983 10.68599 26.40281 9.6632 134.25075 7.73621 184.693 85.35492 41.44955
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 465.40699 824.08779 1152.31822 466.74553 154.13178 6.5801 441.96222 247.56317 287.83096 311.23869 1864.38559 50.6616 153.26066 187.60087
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 29.65251 37.04671 29.65251 30.65886 36.4694 45.35987 29.05055 16.40026 31.66008 19.42014 33.10855 46.91171 44.75541 70.48463
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 5.1678 4.63584 4.75664 4.63584 4.63584 4.63584 7.02071 4.63584 4.63584 4.63584 4.63584 4.63584
* Row count is limited to 100.