Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Myeloid_leukocytes
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:granulocytes_mac1+gr1+ label:macrophage_bone_marrow_0hr label:macrophage_bone_marrow_2hr_LPS label:macrophage_bone_marrow_6hr_LPS label:macrophage_bone_marrow_24h_LPS label:macrophage_peri_LPS_thio_0hrs label:macrophage_peri_LPS_thio_1hrs label:macrophage_peri_LPS_thio_7hrs label:mast_cells label:mast_cells_IgE label:mast_cells_IgE+antigen_1hr label:mast_cells_IgE+antigen_6hr label:microglia
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 8.4182 7.90719 7.99981 5.86782 6.61074 6.1811 6.10343 7.90476 7.4272 7.84138 7.42492 8.20634 28.70671
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 907.30793 2478.60966 2129.25131 3010.15507 663.62398 2249.03298 1619.68211 1094.36347 2081.82119 2697.84832 2081.54832 1916.32381 1261.1739
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 4.63584 4.63584 5.88088 4.63584 4.63584 5.07079 4.63584 4.85311 4.63584 4.63584 4.63584 41.44748
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 147.78182 1015.51065 959.43449 653.55789 574.58424 403.68052 388.04203 185.24203 235.25351 273.6197 353.81134 210.77923 555.56862
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 418.541 992.058 870.35738 111.60414 19.0211 25.99151 18.39093 17.65035 120.29256 68.22881 101.9665 169.8552 238.61049
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 736.19354 944.49761 796.9165 532.44871 1133.4674 1777.5539 1347.32219 1061.77068 1236.83392 4170.90698 1810.11767 1419.30639 1185.9003
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 97.45037 237.64849 172.48475 97.29636 233.45445 151.41162 119.99283 96.67438 1134.90235 591.43552 458.63716 418.23181 75.50456
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 7.79887 18.18084 87.4323 104.98178 14.65364 10.28173 8.01311 18.9256 1131.28157 11.27136 10.27049 26.08523 285.81737
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 5067.6241 17656.0834 15985.64912 8157.99868 6096.32141 6392.23439 6075.26577 3805.79938 1803.09958 7335.70182 6969.06325 4685.08234 5610.31794
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 3381.65286 7701.08235 8130.38024 14668.5526 17956.9341 12109.58616 13558.06793 13007.85961 9171.4152 2820.8231 2890.75078 3517.67901 10423.77579
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 372.73291 153.4635 191.54172 257.05834 213.14568 239.03604 233.91641 522.34988 461.28104 2191.67257 651.35677 939.58618 383.94803
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 372.73291 153.4635 191.54172 257.05834 213.14568 239.03604 233.91641 522.34988 461.28104 2191.67257 651.35677 939.58618 383.94803
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.84609 4.84609 4.84609 4.84609 5.39271 5.60233 10.12536 6.21445 4.84609 6.74978 5.14515 4.84609 4.8999
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 285.25048 268.69094 296.72682 163.51978 306.06318 435.58331 548.49374 253.54274 3443.92336 1748.37642 913.08493 1265.94694 374.95205
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.01234 4.63584 4.63584 4.63584 4.63584 4.63584 6.87407
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 104.18037 33.21996 13.07613 20.27184 87.05314 38.07423 28.69489 23.89893 138.64695 159.58776 96.97543 234.08822 38.68081
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 5.05726 6.26403 6.26403 6.26403 4.84197 5.05726 5.6284 5.6284 5.6284 5.6284 5.38879 4.63584 5.6284
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 9.35735 35.01695 24.04425 11.30027 19.86431 58.99516 22.66959 10.79593 6.7402 9.53027 7.5302 7.41857 66.51694
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.26264 5.20717 4.63584 4.63584 4.63584 5.16549 5.79267 6.42361 5.74549 6.78982 4.99107 5.53011 8.54304
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.26264 5.20717 4.63584 4.63584 4.63584 5.16549 5.79267 6.42361 5.74549 6.78982 4.99107 5.53011 8.54304
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 5.00323 4.82193 4.82193 4.89672 4.81824 4.82193 4.82624 5.19369 4.81761 4.82624 5.00036 4.82624 4.72224
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 5.92814 5.12993 5.08844 6.93708 5.5632 5.58523 5.92814 4.87663 14093.32337 20531.77207 9156.84695 7337.821 5.95161
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 42.41458 221.51531 206.61825 138.31578 158.13266 216.55129 149.17066 60.07874 356.73573 369.21804 179.51767 243.03137 148.97304
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 687.05806 745.54517 705.90443 570.11224 711.70121 1349.25609 1178.4391 446.77489 697.79086 843.91675 744.77889 565.56911 1108.28628
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 31.53914 19.18187 22.54743 16.64604 35.44302 20.51515 23.47631 29.0638 46.91781 33.85315 20.02245 26.85076 27.59887
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 659.55143 2959.47246 2197.34643 1316.67198 1770.47049 3823.51231 3764.83352 1081.08193 1642.86733 415.98269 647.56768 532.27057 1482.62568
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 7.42973 6.21457 6.72453 6.77332 9.70797 56.12927 55.85546 40.83174 4.75796 10.14893 9.23233 11.42005 15.21209
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 376.78686 548.91728 481.38143 886.70992 462.07304 1287.14786 987.02254 1510.67641 940.96143 654.82676 353.77105 208.19689 405.85132
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 5.9145 4.63584 4.63584 4.63584 5.02994 4.63584 5.22431 4.63584 4.63584 4.63584 4.88993 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 7.33861 9.93409 8.67267 16.24164 7.35997 7.23984 7.35997 7.35997 6.47966 7.53869 8.04397 7.35997 7.79994
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.86452 4.7488 4.86452 9.35745 5.84091 4.95829 6.21447 4.86452 5.91207 4.86452 4.86452 4.86452 25.81126
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 5.11335 4.8036 5.09646 7.27322 5.04643 5.2996 4.63584 5.84964 4.93622 5.08522 4.81233 4.63584 4.90035
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 1099.30518 1672.17758 1879.5364 1821.68202 915.0027 1309.46876 1381.7451 1933.34166 4846.3149 2164.88234 2271.54871 1894.13125 1012.33188
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 32.20244 4.96128 7.73557 8.51754 8.58372 5.54932 6.86662 7.09865 15676.01742 9151.51587 4050.03542 3910.49891 243.28678
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 528.17599 231.95243 14.37612 17.62826 27.75574 45.30649 10.06254 12.00351 36.0587 160.68517 266.38741 201.00245 65.51042
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 7.79626 4.63584 4.63584 4.63584 4.63584 4.63584 5.69911 7.48541 4.63584 4.63584 4.63584 4.88173 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 5.38834 7.12171 10.39788 5.31114 5.23503 7.81692 7.98995 5.38834 5.31114 5.2945 5.08135 4.92634 84.93382
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 600.66612 10414.35618 10509.09072 6934.46443 5630.8857 7071.69673 6136.23492 6293.21595 9540.6702 497.09257 2561.45434 4625.7749 8852.20657
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 28.4288 11.5807 7.56587 18.82122 54.72628 14.39209 17.54443 21.36207 114.2201 69.22804 98.56863 39.93116 18.46302
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 12432.00251 8417.00719 8103.81638 5877.1632 12878.16587 14073.49389 14190.11834 13937.13181 14692.45629 28825.3417 20147.34209 16252.27461 13653.84894
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 7263.16432 7439.81474 7829.95033 9249.73514 6662.681 8602.51488 8378.01386 12145.9783 8061.15566 16402.66072 10063.8355 8714.16784 7241.82701
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 185.91206 5.35211 6.19772 8.08607 5.35211 4.78764 8.08743 7.75202 5.48847 6.17906 6.87479 22.8424 1133.76105
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 4.63584 4.63584 5.63683 4.63584 4.63584 5.07455 5.21303 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 79.84299 48.09948 60.03933 29.06418 102.95995 34.88766 55.96277 35.14229 84.13604 43.12216 56.26142 53.39033 54.58544
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 9.67447 9.87266 7.01355 8.34354 7.79282 12.324 8.53977 35.54569 3442.35515 3139.70098 1320.19511 2167.1473 23.27391
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 7.75784 7.29777 6.4959 11.13563 10.74943 19.93926 21.41646 18.52504 5.48713 10.19435 8.39113 7.65557 26.85595
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 5.92165 4.63584 5.52847 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.40634 4.63584 4.63584 4.63584
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.63584 4.63584 5.43484 4.63584 4.63584 7.42006 4.63584 4.63584 5.82587 4.63584 4.63584
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 2007.0935 2615.58472 2444.0075 2394.17468 2627.08972 2254.71525 2028.67048 1646.05891 2547.81219 1336.53937 2097.35954 2397.88553 2771.32106
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 8.96309 7.39082 10.73079 6.80239 24.01162 6.01442 5.9681 9.17969 6.11155 9.0591 10.11097 12.91151 7.85704
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 121.33579 58.66944 67.319 48.90249 55.8909 108.76328 105.54377 100.96181 240.92124 409.75029 255.514 305.64077 59.30544
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 265.22596 386.38658 198.20532 243.19717 844.93273 3596.24405 1886.5332 1786.46463 238.22816 19.91824 62.81789 32.61543 334.27062
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 4.72992 5.64526 5.34691 5.14509 6.64278 5.77511 5.34691 4.94656 4.82591 5.27922 4.63584 4.63584 5.07332
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 5.04028 4.63584 4.63584 5.8271 4.63584 4.63584 5.61959 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 7.33401 4.63584 4.63584 5.70828 4.63584 4.63584 4.63584 4.63584 4.63584 5.02149 4.63584 4.63584 4.88045
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 56.63494 180.88188 180.27731 133.5263 114.69244 249.82535 159.07235 206.39851 356.02578 310.44002 161.98822 179.86088 261.42421
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 56.63494 180.88188 180.27731 133.5263 114.69244 249.82535 159.07235 206.39851 356.02578 310.44002 161.98822 179.86088 261.42421
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 12.05677 6.53094 6.4475 8.61009 6.75536 6.14789 6.14789 6.14789 6.06952 9.12592 9.30075 7.64642 6.3374
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 31.3154 36.20371 42.91975 45.18533 74.95232 40.72347 31.95837 30.41141 87.64622 25.92353 30.41141 31.17529 46.0278
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 34.74377 55.75883 55.65078 41.77135 19.17785 50.18162 59.82283 33.97868 14.37607 15.31848 17.20951 15.31848 335.06225
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 34.74377 55.75883 55.65078 41.77135 19.17785 50.18162 59.82283 33.97868 14.37607 15.31848 17.20951 15.31848 335.06225
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 1761.98361 2158.23578 3020.63431 3447.4006 2288.23434 3836.77579 4451.35328 3454.84387 4458.08494 10300.86637 4398.20872 3729.71517 3022.61742
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.64697 5.22818 5.68489 4.64697 5.27172 4.83478 6.46694 5.53727 4.64697 4.64697 4.64697 4.64697 6.37003
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 490.54511 179.49594 108.52361 50.05041 160.69608 245.84547 154.97218 67.10755 659.16558 1280.98465 533.64354 708.83941 193.71514
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 464.80326 852.97931 537.70364 311.39044 122.0002 107.06365 34.59 77.88921 136.41983 332.78609 157.24193 183.8258 178.67632
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 5.64434 5.64434 5.70902 5.64434 5.64434 5.64434 5.64434 6.47206 5.64434 5.64434 5.64434 5.64434 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 16.64131 8.88552 9.8839 10.88238 10.00214 12.247 11.5151 11.79933 9.50517 8.88552 11.71614 11.22758 17.76742
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.0403 11.01113 7.14389 10.67879 5.21443 5.21443 6.41678 6.83707 5.21443 5.21443 5.21443 5.21443 14.9893
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.94413 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 10.05624 10.46537 7.49349 9.59285 9.49734 7.95627 7.00261 5.8969 6.86736 7.53621 6.55878 6.57438 20.84051
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 6525.36291 6736.07531 5701.44862 5489.1306 5086.99229 6440.65669 5264.87449 6122.97309 7594.0878 14259.44314 8557.61473 7086.11612 8415.22929
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 79.40089 548.76156 571.59019 3088.58906 3606.65018 50.66422 74.96397 854.90462 5.76515 7.86069 8.7917 7.3467 95.17731
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 641.03447 587.66117 498.15393 62.10318 46.37447 29.04771 42.56542 12.98481 12.14088 215.45331 99.59475 181.59896 51.76357
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 8.1088 9.09839 8.49822 9.91953 9.85642 7.18081 9.82303 7.92401 9.90016 8.95138 10.30413 10.57544 11.67651
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 11.8053 7.44722 718.13859 424.26613 11.26506 53.88167 1675.04058 48.39112 160.10198 7.44722 34.44154 6.68725 13.63486
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 41.10811 397.46267 286.51114 83.30391 258.97371 127.53756 126.35508 32.08051 80.17673 47.90791 51.99501 52.90886 141.59353
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 5.40963 4.63584 4.63584 4.63584 4.63584 4.63584 5.22759 4.63584 4.63584 4.94643 4.91725 4.63584 4.63584
* Row count is limited to 100.