Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

PEDB motif - Gene Atlas mashup table

Open Smart Phone View

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
Show API List
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Osteoblasts_Osteoclasts
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:osteoblast_day5 label:osteoblast_day14 label:osteoblast_day21 label:osteoclasts
#object_type_xsd string string string float string string integer integer integer string string string string float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 410.77243 407.20351 286.11675 7.04521
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 783.47349 657.70089 762.87872 1650.02289
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 4.63584 4.63584 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 1999.29741 2191.55532 1283.15699 1004.52087
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 458.16743 344.55767 151.02458 1250.08957
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 1075.34091 1090.3043 1129.21789 1488.20056
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 97.24962 110.71436 127.42976 109.57373
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 8.14576 7.59773 8.08228 8.12841
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 4523.98122 4005.45893 3813.69135 13356.30836
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 2718.07701 3077.99562 4159.05909 8455.94043
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 407.0291 487.94313 526.14342 233.55581
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 407.0291 487.94313 526.14342 233.55581
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.84609 5.50381 5.65821 5.06871
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 189.51581 176.88956 150.11949 257.5913
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 40.02892 110.15646 107.87749 4.63584
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 28.35582 38.4753 40.34397 52.20656
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 5.51715 5.4721 5.47697 6.26403
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 212.8541 400.2774 444.53962 34.39903
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 40.51053 54.6855 40.71515 5.38819
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 40.51053 54.6855 40.71515 5.38819
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 4.82624 4.82193 4.82624 4.82624
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.74762 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 6443.80271 5726.36991 4379.89357 5.35274
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 120.24008 160.65782 135.02858 288.73267
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 533.40377 679.94838 682.27673 806.16968
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 35.94417 40.89657 41.17784 29.74115
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 723.06863 605.87 544.66475 4473.27468
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 229.31893 179.8404 69.63857 21.22959
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 177.27759 157.56585 185.73608 509.41314
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.63584 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 7.33228 7.66378 7.98013 7.35997
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.80969 4.79992 5.29508 4.8487
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63584 4.63584 4.63584 4.99915
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 1040.7959 987.66571 1135.04938 1248.2903
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 19.01653 7.32617 24.00716 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 3860.77538 3279.01581 3325.53421 96.66571
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 19.1 21.61631 19.8756 70.17489
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 4.63584 4.63584 4.63584 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 430.52125 357.62292 277.03582 429.33713
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 14217.02918 9790.14197 7250.05437 14189.26096
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 11.3854 31.21687 38.10759 14.71241
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 11.3854 31.21687 38.10759 14.71241
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 11.3854 31.21687 38.10759 14.71241
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 21.15764 18.82122 19.69053 12.50254
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 18482.12383 18408.88479 17184.5001 12782.03201
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 39.38425 50.24454 450.32271 7437.56703
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 8366.29767 13207.44527 11582.23322 81.80343
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 5.36401 4.63584 4.98429
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 82.45156 51.26067 57.55744 48.50773
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 8.44757 10.20936 9.28171 138.33262
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 559.24304 594.0884 543.60519 10.18097
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 4.63584 4.63584 4.76668 4.63584
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.63584 4.63584
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 3663.28043 3151.32796 3077.12024 3903.17564
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 6.08342 5.38733 5.28033 5.39265
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 25.03584 33.97226 34.27542 69.00062
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 272.95326 241.22769 258.29081 547.86128
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 88.48281 315.60106 333.03855 4.94266
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 4.63584 4.63584 4.77636 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 4.63584 4.63584 4.63584 4.71826
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 310.38859 274.91468 229.7538 304.34707
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 310.38859 274.91468 229.7538 304.34707
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 9.58129 6.59262 6.00954 6.14789
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 55.52699 120.7024 132.28331 51.39234
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 354.69204 176.01781 261.41716 640.67568
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 354.69204 176.01781 261.41716 640.67568
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 4203.74521 4107.7176 4408.14803 2416.39186
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.97908 5.42816 4.93613 4.64697
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 164.52546 173.02822 204.27791 193.4677
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.63584 4.63584 4.63584
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 728.19944 559.97638 304.69279 586.53648
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 6.21577 7.88266 7.01056 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 24.69396 33.68646 45.39033 8.99373
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 4.91663 4.99883 4.91663 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 129.30152 59.70657 34.69336 14.49795
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 5567.37003 5728.36385 5542.88148 6488.50331
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 2408.80901 1313.94947 716.7865 389.85502
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 192.18318 163.50012 68.87538 710.34149
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 7.87783 9.39231 8.6964 11.04505
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 26.26966 6.75546 4.68602 11.96329
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 113.70989 94.52385 81.94093 227.71936
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 4.63584 4.63584
* Row count is limited to 100.